Edward L Stephens

US Patent:

20070122813, May 31, 2007

Filed:

Oct 1, 2004

Appl. No.:

10/574645

Inventors:

David Salomon - Frederick MD, US
Nancy Berman - Leawood KS, US
Edward Stephens - Kansas City MO, US

International Classification:

C12Q 1/68
C12P 19/34
A61K 39/395

US Classification:

435006000, 435091200, 424146100

Abstract:

A method of detecting a neurodegenerative disease in a mammal, which method comprises assaying the copy number of a Cripto-1 gene or the expression level of a Cripto-1 gene product in the central nervous system of the mammal, wherein an amplification of the Cripto-1 gene or an overexpression of the Cripto-1 gene product is indicative of a neurodegenerative disease in the mammal; a method of inhibiting progression of a neurodegenerative disease in a mammal, which method comprises administering to the mammal an agent that inhibits Cripto-1 in an amount effective to inhibit Cripto-1 in the central nervous system of the mammal, whereupon the progression of the neurodegenerative disease is inhibited; and an isolated or purified oligonucleotide consisting essentially of the sequence of AAGCTATGGACTGCAGGAAGATGG (SEQ ID NO: 3) or AGAAGGCAGATGCCACTAGC (SEQ ID NO: 4).